1 de mayo de 2018

DIEZ, Mini, DIEZ!

Querida Mini

Como dicen por ahí, hoy pasas a las dos cifras, cumples 10 años. Sabes que es uno de mis números favoritos? Cuando jugaba al baloncesto yo era el 10... un 10 que me cosió la Yaya en una camiseta roja.

Estos últimos 12 meses han sido un poco montania rusa. pero te aseguro que tú siempre has estado en los altos. Seguro que ya lo has olvidado, pero durante tus 9 años hizo 20 que tus padres aterrizaron en tu isla y 25 de aquella famosa foto, a los pocos días de conocerse. Todo esto te debe parecer estratosférico, imposible, 20, 25 años... cuando tú justo indicias tu primera década. Disfruta de la lentitud: no sé en qué punto todo empieza a tomar muchísima velocidad y eso sí que es una montania rusa. Ah, y lo peor: aquellos veranos de la infancia, eternos, ya no vuelven. 

Hablando de veranos, este fue el año en el que me di cuenta que no disfrutabas tus veranos en la península. Tu aitá piensa que es una fase, pero de momento nos has salido demasiado inglesa, y lo que quieres es estar aquí en los horribles agostos. Te he contado alguna vez que el verano aquí se acaba a mediados (con suerte) de agosto? Sí, a mí me costó años entenderlo, optimista por naturaleza, pensaba "habremos tenido mal verano". Una año tras otro. Pues no: te lo confirmo. 

Siguiendo con el verano pasado, tal vez lo mejor fue que descubriste Bellver, la Cerdanya, y te encantó. Pasaste a compartir pasión con tus tíos por el pueblo de la Yaya. Te encantó la sensación de libertad, poder ir sola por la calle, las casas de piedras, el río, las vacas en los prados...

En Septiembre comenzaste el Curso 5, y ahí estamos. Solo te queda un año de primaria y los espeluznantes 11+ (los exámenes para obtener una plaza en otro cole de secundaria)... me temo que en el blog vamos a hablar bastante de este frenesí en otoño...

La semana pasada, por fin pudimos hacer el regalo que te habían dejado los Reyes: era una visita a los estudios de Warner Bros., donde se filmaron las 8 pelis de Harry Potter. No sabías nada hasta que llegamos a la puerta, y allí saqué la capa del disfraz e hicimos la visita... nunca olvidaré tu cara, cubriéndote la boca de emoción, cuando te adelantaste y viste la sala donde se recrea la estación de tren... o al final, donde está la maqueta 1:24 de Howarth...

En estas que estoy escribiendo y pasas por aquí y .aceptas escribir un poco... seguro que todos prefieren que remates el divague, así que yo termino con MUCHAS FELICIDADES RUBIA, que pases un día maravilloso y que en los diez  lo pases chimenea!



"Hola, soy Mini, la que siempre se olvida escribir en su Blog. 10 años para mi es como raro, me siento rara, pero, luego me acuerdo cuantos años tienen mis padres y luego ya no me siento tan viega. Algunas veces durante el año, no puedes esperar para tu cumple, estas emocionada todo el ano, eso es lo que me pasa a mi todo el año, de hecho, obligaba a mis padres poner cuantos dias faltaban para mi cumpleanios en mi pizzarra TODOS los dias en una epoca. Bueno, cuando solo falta un segondo para mi cumpleanios, yo me sientia como he esperado tanto para este momento, pero luego, no termina como yo planeaba. Siempre me miro como una persona mas dedicada cuando cumplo cada ano, pero, como ya te puedes imajinar, soy la misma persona, no cambio y posiblemente nunca cambiare. Veras, yo nunca encuento el tiempo para escribir en mi blog, mi madre siempre esta, tacatacatacatacatacatacatac con el ordenador. Este ano, voy a intentarlo de nuevo, y si para por lo menos un semana funciona, ya te dire.

No puedo espera para mi cumpleanos, un martes con mis amigos, me siento viega pero alegre y siempre tengo ganas de pasarmelo bien. Con eso dicho, muchas gracias por leer mi parte de la historia y espero que difruties lo resto que pondra mi mami. Adios!!!!😊😊😊😊😊😊😜😛😘😁😁😝"


30 comentarios:

  1. Eyyy Miniiiiii.... muy muy feliz cumpleaños. Es el cumpleaños de las dos manos. Le mandaré a tu madre por wasap tu caminito de chuches. Y me ha encantado lo de Mi madre siempre está tacatacatacataca... algún día agradecerás todo lo que ha escrito aquí. Muy feliz cumpleaños, que tengas un día genial y tu madre te deje comer huevos fritos con patatas y tarta.

    ResponderEliminar
  2. No dejes que nada te robe este período de tu vida, porque lo vas a recordar siempre y en los memomentos menos buenos los recordarás y esa será la mejor manera de arreglar tu vida.

    Así que felicidades por los 10.

    ResponderEliminar
  3. Recibido el caminito de chuches MO! Lo de los huevos fritos con patatas suena idílico si lo comparmaos con el "programa" de cena q tenemos hoy (diseniado por MIni, claro)... igual leéis algo en la prensa hoy...

    Gracias NAN... toda al razón, quien decía lo de la unica patria es la infancia? Una infancia feliz, el puerto más seguro al q volver.

    Hace un día luminoso en Londoninium, están los abuelo,s y han llegado hoy los tíos para el resto de la semana.... abrochénse los cinturones... :)

    Love

    di

    ResponderEliminar
  4. "La infancia es la verdadera patria del hombre" es una frase de Rilke. Con la que estoy totalmente de acuerdo. Nunca he sido yo mismo como hasta cumplir 11 o 12 años, fecha en la que la doma social surtió un efecto devastador.

    ResponderEliminar
  5. Un instante de cobertura para felicitar a Mini. ¡feliz cumple,mayorzota!

    ResponderEliminar
  6. Deseo, Mini, que hayas sido muy feliz en este día tan especial de tu cumpleaños. Alguien podría decir que todos los cumpleaños y todos los días son especiales, y no le faltaría razón. Pero, caramba, cumplir diez no es cualquier cosa ¡es cumplir diez! Eso lo entendemos todos los que, haga poco o mucho, también hemos cumplido diez años. Y es que cumplir décadas completas tiene algo, no sé si simbólico o real, muy poderoso: 10, 20, 30, 40, 50, 60, 70, 80, 90… y, ¡ejem!, digamos, etcétera.

    El texto que nos dedicas me ha gustado mucho porque haces dos observaciones muy importantes que, además, demuestran la madurez que vas alcanzando a grandes pasos. Una, es la sorpresa que te produce que los momentos muy ansiados no terminen como planeabas; otra, que, por años que pasen, siempre te sientes la misma persona.

    Al respecto de lo primero, hubo un poeta que dijo lo mismo que tú sólo que cambiando un poco las palabras: «Pero también / la vida nos sujeta porque precisamente / no es como la esperábamos». Y es una idea preciosa, esperanzadora. Y es que la vida no es tanto lo que nos pasa sino cómo nos tomamos lo que nos pasa.

    Respecto a lo segundo, aunque uno, efectivamente (y afortunadamente), no cambia en lo sustancial sí cambia en aquello que, estando en su mano, quiere cambiar: tener más voluntad, ser más disciplinado o estudioso, escribir o leer más… En fin, en esas cosas, si se quiere de verdad, sí se cambia, ya lo creo: se cambia ¡porque sólo depende de nosotros cambiarlas!

    Felicidades de nuevo, joven amiga.

    ResponderEliminar
  7. Gracias a todos! Aun recuperándome d ela sobredosis de azucar... y esto no ha hehco más q empezar.

    Gracias Nan por el autor de la cita... :)

    CESI está de puente! O el instante de cobertura es metafórico.. besos my lovely.

    Gracias LUXI.. se confirmó lo de "los momentos ansiados no terminan como planeabas"... a Mini no le gustó ningun regalo... a ver, es q yo estaba anclada en una fase de "le gusta todo lo q sea de escritorio" y así aconsejé a todo el mundo y ayer ocnfirmó: "ya no me gusta lo de escritorio"... mientras q abría rotuladores con brillantina, seta q es goma y sacapuntas a la vez, helado donde las cada bola d ecolor es un rotulador ... etc... un fracaso. Tb hubo libros y eso, pero no sé q esperaba.. ella misma no lo sabe...

    Sobre lo de se cambia... cuanod escirbió "dedicada" creo q estaba traduciendo del "dedicated".. supongo q no se cmabia d eun día a otro, pero estoy de acuerdo contigo, Lux,q se cambia.. si no, de qué aquella distancia ocn amigos d ela infancia o adolescencia, con los q ya no compartes nada?

    Os mando abrazos

    di

    ResponderEliminar
    Respuestas
    1. Este comentario ha sido eliminado por el autor.

      Eliminar
  8. No te me pongas moña,Lux, muchacho, por un ligero retraso de ¿una semana? Más tiempo pasó el prota de la novela en la cárcel, saliendo a entrenar todos los días, y no era tan quejica como tú.

    De momento, he hecho dos ligeros intentos de encontrar el libro en mi bliblioteca (una especie de enfermedad en forma de araña que se extiende por toda la casa) para releerlo por encima y decir algo con sentido. Pero no he podido encontrarlo.

    ¡Otro año será!


    ResponderEliminar
    Respuestas
    1. ¿Moña? ¡¿Me ha llamado moña?!

      ¡Agarradme, que me pierdo…!

      Quillo, NáN, déjate de rollos y escríbenos ya de The loneliness of the long-distance runner. No me hagas, como siempre, ir a Wikipedia para fingir que lo he leído y visto. En serio, que según lo que digas me descargo la película y el libro.

      Moña, dice…

      Eliminar
    2. Anda que cómo te pones. No he encontrado el libro. Será mejor que te bajes la peli. Es magnífica, con un blanco y negro de frío muy apropiado al tema.

      ¿Estamos en paz, churumbel?

      Eliminar
    3. Este comentario ha sido eliminado por el autor.

      Eliminar
  9. ¡¡Muchas felicidades, Di! que hoy eres tú la chica del cumple. Saturada de azucar como estás, espero que hoy te pongan unas deliciosas acelgas (mis favoritas son las que llevan pasas y piñones) ¡Un montón de besos; guapa!

    ResponderEliminar
  10. Hola darlings! Muy tarde vengo de las calles (pensad q hay una ninia envuelta) y me encunetro con todas las felicitaciones, gracias al peaso disco duro cesita.... mil gracias sois lo mas... y la felicitacion de sandia... buffff q chula... pero acaso yo he dixho alguna vez q AMO la sandia????

    Muaks

    Di

    ResponderEliminar
  11. (Lo de las acelgas, sì, claro... por cierto tenemos! Las vende waitrose!

    ResponderEliminar
  12. He dejado pasar 24 horas desde la pésima noticia. De tener que, aquí, transmitirla yo, quería, por la conocida estima que le tengo, darla con naturalidad o hacer como si no urgiera. También, lo admito, confiaba que fuese entre nosotros otro el que diera la aciaga información (nunca he tenido vocación de injustamente ajusticiado mensajero), pero ya veo que, tratándose de vosotros, fue mucho mi confiar.

    Este año NO se entregara el Nobel de Literatura. Sí, habéis leído bien.

    ¿Marías, Di, el favor de publicar esto?

    Todos somos Javier; apoyémoslo, apoyémonos.

    ResponderEliminar
    Respuestas
    1. Desde que me he enterado, llevo horas apoyáo en el quicio de la mancebía.

      Eliminar
    2. Si habré oído veces lo de «el quicio de la mancebía», pues, te lo creas o no, NáN, hasta ahora (al leértelo a ti) no me he puesto a averiguar qué significa.

      Aquí, le pasó lo mismo a C. S. con «Sin solución de continuidad? ¿Eso qué quiere decir, que no hay forma de que la cosa continúe o que dicha continuidad sigue estupendamente, sin disolvierse?

      Cosas…

      Eliminar
    3. Yo también estoy perpleja con lo del quicio de la mancebía. Es obvio que la mancebía está abierta, pues de lo contrario NáN se apoyaría en la puerta. Pero ¡¿qué hace NáN ahí?! ¿Piensa entrar? ¿acaba de salir? ¿Controla el tráfico de personas y mercancías? Descarto por imposibles todas estas opciones. NáN nunca practicaría tales actividades. Debe ser una metáfora de que está en un sitio en el que jamás deberíamos buscarle, como al pie de un cañón, en Babia o en la luna de Valencia. Si la tal mancebía estuviera en una calle seguro que es mas probable que le encontráramos al cabo de ella que en el quicio del local. En tales ciscunstancias NáN estaría desubicado. Desubicado sin solución de continuidad...

      Eliminar
    4. Me reconocerás, C.S., que la siguiente frase es "miraba encenderse la luna de mayo". Y que dado el mes en el que estamos, eso cuadra perfectamente.

      Pequeños vicios que tiene uno. Como fumarse un cigarro en el quicio de la mancebía, en lugar de hacerlo en la puerta de un centro de jubilados.

      Eliminar
    5. Pues has de saber, Lux, que NáN anda por tu vecindario, pese a que tales mancebías se denominaban "Boticas" en la Sevilla del XVI. Sin embargo, una real ordenanza de 1621 divulgada en la célebre ciudad decía así: "Item porque hay mugeres en la dicha mancebía que tienen aposentos alquilados fuera de ella, donde van a dormir de noche con hombres fingiendo ser mugeres de más calidad, se hordena y manda que en dando las oraciones antes que anochezca las dichas mugeres estén y se recojan en la dicha mancebía y en ella duerman, so pena de quinientos maravedís". Por otro lado, "el quicio de la mancebía" hace alusión a "las bisagras que no dejan dormir", y en una célebre canción del padre de Ángela Molina, "Ojos verdes", se decía "en el quicio de la mancebía", línea que el bizarro coplero tuvo que cambiar por "en el quicio de tu casa un día". Por tanto, Nán no está en una casa de lenocinio: no ha podido dormir, ha alquilado un piso para estar con una manceba o se le quedó la copla de Miguel Molina. Es que tú y CS sois unos malpensados...

      Eliminar
    6. Este comentario ha sido eliminado por el autor.

      Eliminar
  13. Jei darlings

    SE ha terminado ya la semana de fastos rituales cumpleanieros (falta el Peda , el sábado, pero tras los excesos ha dicho q solo quiere ensalada, y q no le feliciten), y ayer ya volaron a la pensínsula los Jekes y padres, y además hoy es aquí FESTIVO!!! (me crezco, cada (rara) vez q es festivo aquí y no en la península).

    He leído con gusto vuestros divagues si no sabría por donde empezar... ah sí, primero entonar un mea culpa con LUX, q por culpa nuestra (vuestra) quema complejos platos de cocina de autor (el otro díá en un pub el Peda pidió lo q creía q eran calabacines rebozados-como si esto fuera un país mediterráneo cualquiera-y nos sacaron calabacín cortado como en spaguetti con tomatitos cherry, así a modo de ensalada de autor-jua!).

    Divago: de lo de la mancebía no puedo entrar pq doctores tiene el divlog... he visto la canción de los ojos verdes, q spr son de mala. La entrada de CESI me parece sublime y el Sr Snoid me ha abierto los ojos a q Mini escribe en ESPANIOL ANTIGUO! lo de viega por vieja, por ejemplo... gracias!

    Y hablando de MIni, tengo q ayudarle con mates... :(

    see ya

    ResponderEliminar
    Respuestas
    1. Este comentario ha sido eliminado por el autor.

      Eliminar
    2. A ver si ahora me sale bien:

      No se hable más, Di, si Peda ha pedido que NO le felicitemos el sábado por su cumple no seré yo quien cuelgue esto.

      Por otra parte, la berenjena, partida por la mitad, rellena de lo que sea pero horneada y servida en su propia piel es una exquisitez que ni ojo oyó ni oído vio. Que conste. Es darle una tenedorada (por supuesto, el tenedor ha de ser de madera) a esa parte currusca cual pan mezclada a voluntad con el interior jugoso y el crujir de dientes y rechinar de nalgas asoman sin remedio ni tasa. Ojito pues. Hay gente que no ha vuelto de esa experiencia.

      Eliminar
    3. Ay LUX, muchas gracias por la no-felicitación q no has colgado... lo de Keep Calm es muy apropiado pq ... no hay q ser tan histérico con q no te feliciten, no?

      A mí la berenjena tb me encanta pero a mí horneado spr me sale seca... lo hemos hablado ya aquí? no recuerdo, pq sí q hemos tenido otras sesiones de cocina (más bien, algunos de vosotros intentando lo imposible conmigo), pero sigo con las berejenas duras, así q tal vez no.

      Claro q ahora ya se ha ido la tropa y estamos intentando superar los excesos con una semana monacal... toda la comida es muy aburrida.

      Tal vacío ha dejado la tropa q estoy hasta con principios de "bloqueo de la bloguera"... sí, sí, no me ha pasado muchas veces, pero alguna sí...las voy a buscar... estoy un poco en blanco...

      love

      di

      Eliminar
    4. Llamadme impulsivo o visionario, pero en estos días de silencio he alcanzado el firme convencimiento de que urge abrir aquí una sección de cocina que bien podría llamarse Cocina Di-charachera.

      Pienso que si esta propuesta fuese secundada por el Consejo de Redacción y aprobada por la Di-rección, mejorarían sensiblemente nuestras vidas, pues, sin ir más lejos, una vida sin berenjenas sequeronas es una vida plena.

      Las recetas prácticas que intercambiásemos deberían ser herencias familiares (nada de bajárselas de la Internet donde siempre –siempre es siempre- mienten con, por ejemplo, los tiempos de cocción y el punto de sal) y ser platos que hagamos con frecuencia y con ingredientes asequibles por todos. Naturalmente, el compromiso sería que todos hiciésemos el plato del mes (un plato por semana sería una tensión antipática, pero una vez al mes creo que todos podemos asumirlo) que, también entre todos, votásemos: algo así como un club de lectura pero en versión agradable, digo, culinaria. Deberíamos mandar a la redacción una foto del plato resultante.

      Veo los artículos con cuatro secciones: Antecedentes, En el mercado, Ingredientes (para, propongo, tres personas) y El proceso.

      Para no alargarme, así, creo, podrían ser las dos primeras secciones:

      Cocina Di-charachera; Hoy: berenjenas rellenas

      Antecedentes:

      La berenjena, rica en potasio, es una planta de fruto comestible del género Solanum. Como toda la familia de las solanáceas (tomate, patata, pimiento y un corto etcétera) tiene aspecto de tío tonto. Pero de tonto noble, no de tonto malo. Se presta a los juegos de palabras de inspiración sátira. En el reino animal su equivalente o alter ego es la nutria. Es pubescente, cosa no es buena ni mala, pues la pubescencia está en los ojos del que mira, lo cual, por cierto, es la primera causa de las consultas oftalmológicas en el primer mundo. Es hermafrodita y de pocas palabras si alguna tiene. Está extendida la errónea idea de que vino de América, pero es al revés: fuimos los españoles quienes llevamos la berenjena a América, con todos los gastos pagados… Y hasta aquí puedo leer, con, a lo Mayra, breve risita porcina y golpecito con el índice encogido en la puntita de la nariz.

      En el mercado:

      Para acertar con las berenjenas (que no estén verderonas, amargas, fofas o con más pepitas o granos que un silo asín de los grandes que vemos desde el tren) deberemos elegir las que tengan el tallo verde y firme, piel brillante y lisa, sin sospechosos cambios de color —no me refiero, naturalmente a las entreveradas sino a las manchas que indican avería— y de tamaño medianito. Y la prueba definitiva: Un suave apretoncito, y si la carne se hunde un poco pero luego recupera su forma: está en su punto.

      Bueno, y luego seguirían los Ingredientes y el Proceso.

      Gracias, gracias.

      Eliminar
    5. Qué gran idea LUX la cocina Di-charachera... venga, termina lo de las berenjenas y inauguramos el distintivo!!! (quién me iba a decir a mí q tendría una sección de cocina!).

      Conté q JAL abrió una vez un blog con recetas de la Yaya? Esto fue hace siglos, cuanod yo no sabía lo q eran los blogs, y ahora parece q no está.

      Yo me lanzaré con mis legendarios HUEVOS RELLLENOS... tengo unos pocos platos, pero todos son épicos.

      Me ha encnatado q tienen las berenjenas aspecto de tio tonto... o del apretoncto, fatal... una vez le dije a un ninio q no se metía el dedo en la sandía (q estaba envuelto ese trozo en film) y su madre me echó la bronca (sí, la misma madre q asistía al acto pasiva)

      Love

      di

      Eliminar

¡Bienvenid@ a DD!

Poniendo aquí tu comentario te arriesgas a que los divagantes continúen divagando.