17 de mayo de 2018

Gorditos vs. Malotes (Héctor vs. Aquiles)

10 divagues
La Dra. Di escasamente pasa por este divlog, pero reconocedlo: la amáis. Un placer culpable, vale, pero convengamos en que cuando nos ilumina, queremos desenterrar el hacha de guerra, véase aquí, o acá. Pues bien, divagantes, hoy sale otra vez de su baúl (tras la entrada anterior, no sé si es la mejor expresión) para deleitarnos con un tema de máxima actualidad. Los hombres, gorditos o malotes?

Empecemos por los clásicos. Tomemos la Iliada y a sus dos guerreros tótem: Héctor y Aquiles. Héctor es un hombre familiar, que intenta evitar demasiado derramamiento de sangre, mientras que Aquiles es individualista y centrado en su propia sed de gloria. En Héctor puedes confiar: es leal y valiente, mientras que Aquiles es impredecible, indeferente a los otros y obsesionado con su honor. Héctor tiene un carácter moderado, mientras que Aquiles tiene tendecias iracundas ("Canta, oh diosa, la cólera de Aquiles"). Héctor se debilita en el combate final, mientras que Aquiles se crece en la violencia de la batalla. 

Héctor es un gordito, Aquiles, un malote. 

Sigamos con el presente: el concepto "gordito" se lo debemos, una vez más a la Gran Fashion, que heredó de su abuelo la capacidad para inventar motes, todos sangrantes, para el que se le tuerza. Por su paleta pasan seres tanto particulares  ("Navajas", su jefa, "el Galgo", "las ciguenias") como conceptos elevados a categorías: "los estufas", "las tietas" y, cómo no, los "gorditos".

Un gordito es... a ver, que el Fary nos lo explica mejor:

Gracias Fary por tu valiente testimonio. Queda claro: el gordito es el "hombre blandengue", aquel tipo que nuestro filósofo detesta, que va a la compra y empuja un carrito de bebé. Pero, a ver,  que ya superado el Zenozoicono no es tan fácil, a todas nos gusta (ayyy, "pícara") que bajen a la compra y cambien paniales, que tontas no. Pero hay muchas que siguen comprando el mito del macho alfa. 

Yo he visto cosas que no creeríais, vivido casos extremos (me diréis):  ya en la facultad, una compa muy guapa nos decía que aquel creído que a mí se me hacía insufrible, "cuando peor me trata, más me tiene". Otra se lió con el hijo de una familia bien de Vetusta que venía a la facultad con su GTI y era un precusor de los ninis, pero con visa-de-papi. Otra amiga ya en la veintena, también atraída por el Eau-de-Testoterone acabó con un tipo que nos echaba unos monólogos del diez-encantado de haberse conocido, apasionado en solitario de escucharse- y que se destapó que se lo montaba con varias de la misma empresa!

Un gordito no haría eso (en principio, claro, siempre te pueden sorprender, también se ha visto más allá de Orion). Un gordito no es tampoco un pedazo de carne con ojos, lo queremos con chispa. [Nota importante: un gordito no tiene que ser necesariamente gordo].  Un gordito es buena gente, alguien que ayuda a los demás, que no piensa cosas raras ni hace mil lecturas de una cosa, y que no te va a decir que te has de hacer las raíces. Un gordito te llama cuando le apetece porque quiere hablar contigo. A un gordito le encanta todo lo que te pones. Un gordito no va a ir a socorrerte en plan damisela en distrés. Un gordito no es celoso. Un gordito te hace reír, y siempre empieza por reírse de sí mismo.

Un malote es otra cosa. El malote es una actitud, y se llama arrogancia, morritos, miradas (que a ciertas edades provectas ya nos dan risa). Un malote puede ser inseguro, de hecho muchos lo son, pero su lait motif es intentar vender al mundo la moto de que él es lo más. El malote es fachada. El malote es aquel que está contigo y le pega un barrido a la tía buena que entra en el bar. Un malote deja activamente días sin llamarte para que pienses que no está desesperado por ti, y que está ocupado con su gran vida social. 

Mirando al futuro: chicas, no compren más la moto aquella. Por si no está claro: soy del equipo Gorditos! Pon un gordito en tu vida. O nada. 

Di y el último malote

12 de mayo de 2018

El tarado

26 divagues
No se me toma en serio cuando hablo de lo del tarado.

El concepto del tarado entró en las vidas de casi todos nosotros de manera así un poco peliculera: corría 1994, y fue con "Pulp Fiction", donde unos sórdidos tipos que regentaban una sórdida tienda de armas en algún punto de la sórdida América profunda tenían a un tipo en un baúl, vestido de cuero hasta la máscara, que era solo sacado para vejaciones y abuso sexual. El "gimp" en inglés  es tanto alguien con algún problema físico, una cojera, pongamos, pero también significa sumiso sexual. La traducción de gimp que le dieron en la peli como  "tarado" es,  cuando menos, erm... interesante. Pero se introdujo como la imagen de la izquierda en el imaginario colectivo.

Antes ya habíamos visto "El silencio de los corderos" y luego vinieron casos de espantosos monstruos como aquellos austriacos, que tenían encerradas a pobres chicas en sótanos durante anios. Igual que en el caso de la peli de Tarantino, una veía a posteriori la foto de esta panda y pensaba: culpables, puros malos de serial. Pero en general, cuando cosas de estas pasan, siempre salen los vecinos, sorprendidos, diciendo  diciendo "no salimos de nuestro asombro, quien lo iba a decir, parecía un tipo tan majo, un ciudadano ejemplar", y esas cosas.

Esto último me lleva a querer investigar los extranios ruidos que desde hace un tiempo se oyen de vez en cuando en mi casa. Lo han oído, aparte de los habitantes regulares del piso, los visitantes. Se trata del sonido que haría una persona amordazada: "mmmm  mmmm". Si se me apura, podría también sonar un poco a vaca aburrida, sin energía, pero categóricamente, no suena a paloma (que es la hipótesis del Peda).

Me he puesto a investigar el asunto. Los primeros sospechosos son mis vecinos de edificio: los Vaquerizos, de arriba, ella se acaba de quedar embarazada, parece improbable que tengan a alguien en un piso de una habitación para sexo raro. Los de abajo, una pareja encantadora de irlandesa-australiano, tampoco. Luego queda Rose, la septuagenaria obsesionada con la seguridad. Rose vive en la planta baja y también tiene el semi-sótano aquel típico de Londinium (véase "Sola en la oscuridad").  Cómo olvidar la historias de Rose, pero para quien no sepa, aquí se narran algunas de sus peculiaridades, desde "tengamos el jardín de delante hecho una selva para que así los ladrones se desincentiven pensando que somos pobres" hasta "alguien ha puesto celofán en la basura de reciclaje y el celofán no se recicla" pasando por "no tengo internet, móvil, microondas, largo etc, por las amenazas que suponen" o "desinfecto regularmente los enchufes del pasillo-pero solo los de abajo". Sí, estáis pensando lo mismo que yo: Rose es la primera sospechosa, además tiene el semi-sótano, y las preocupaciones de seguridad-que pueden ser en realidad miedo a que se descubra su zulo con el gimp. 

No he descartado las casas a los dos lados: a la izquierda todo el edificio es de un dentista, porque hay cartel, pero jamás he visto entrar a nadie en consulta. El así-llamado-doctor es de origen pakistaní y lleva barba tipo Abraham Lincoln, solo por debajo, y se la tinie de roja: da mucho miedo. Nunca he visto entrar ni salir a nadie de la casa que sugiera una vida normal, no sé, con bolsas del supermercado, por ejemplo. Todo suena a tapadera. 

Fiesta "Vigilantes de la playa" de los vecinos
En la casa de la derecha hay varios apartamentos, como en la mía. En la planta baja había antes una pareja de gays que montaban unas fiestukis impresionantes en el jardín. Yo creo que se debían dedicar a los musicales, o algo. Por ejemplo, el verano pasado el tema fue "los vigilantes de la playa", y hasta trajeron arena! Montaron una piscina con hinchables dentro, Pamela Anderson y demás personajes recortados en tamanio natural, chiringuito de playa con daikiris, y todo el mundo disfrazado con camisetas de aquella de "Baywatch". El anio anterior había sido "Brasil" y lo mismo. Creo que se han cambiado y me dará mucha pena no poder ver su fiesta anual, que ríete del MET, desde mi ventana. 

Una vez aclarados los sospechosos, mi siguiente paso es recoger evidencia. Ayer por la noche, cuando estaba poniendo a Mini a dormir, "mmm.... mmm". Corriendo cojo el teléfono, pongo a grabar... pero entonces, calla. Paso un rato esperando, a punto de grabar, y nada. Va a ser difícil, y además, no cuento con un equipo de grabación de esos de las peli, entendedme. 

Pero nadie me da crédito. Me siento como Diane Keaton en "Misterioso Asesinato en Manhattan". Yo sola frente a un misterio, y acaso no había muerto en la peli de Woosy Allen? 


1 de mayo de 2018


30 divagues
Querida Mini

Como dicen por ahí, hoy pasas a las dos cifras, cumples 10 años. Sabes que es uno de mis números favoritos? Cuando jugaba al baloncesto yo era el 10... un 10 que me cosió la Yaya en una camiseta roja.

Estos últimos 12 meses han sido un poco montania rusa. pero te aseguro que tú siempre has estado en los altos. Seguro que ya lo has olvidado, pero durante tus 9 años hizo 20 que tus padres aterrizaron en tu isla y 25 de aquella famosa foto, a los pocos días de conocerse. Todo esto te debe parecer estratosférico, imposible, 20, 25 años... cuando tú justo indicias tu primera década. Disfruta de la lentitud: no sé en qué punto todo empieza a tomar muchísima velocidad y eso sí que es una montania rusa. Ah, y lo peor: aquellos veranos de la infancia, eternos, ya no vuelven. 

Hablando de veranos, este fue el año en el que me di cuenta que no disfrutabas tus veranos en la península. Tu aitá piensa que es una fase, pero de momento nos has salido demasiado inglesa, y lo que quieres es estar aquí en los horribles agostos. Te he contado alguna vez que el verano aquí se acaba a mediados (con suerte) de agosto? Sí, a mí me costó años entenderlo, optimista por naturaleza, pensaba "habremos tenido mal verano". Una año tras otro. Pues no: te lo confirmo. 

Siguiendo con el verano pasado, tal vez lo mejor fue que descubriste Bellver, la Cerdanya, y te encantó. Pasaste a compartir pasión con tus tíos por el pueblo de la Yaya. Te encantó la sensación de libertad, poder ir sola por la calle, las casas de piedras, el río, las vacas en los prados...

En Septiembre comenzaste el Curso 5, y ahí estamos. Solo te queda un año de primaria y los espeluznantes 11+ (los exámenes para obtener una plaza en otro cole de secundaria)... me temo que en el blog vamos a hablar bastante de este frenesí en otoño...

La semana pasada, por fin pudimos hacer el regalo que te habían dejado los Reyes: era una visita a los estudios de Warner Bros., donde se filmaron las 8 pelis de Harry Potter. No sabías nada hasta que llegamos a la puerta, y allí saqué la capa del disfraz e hicimos la visita... nunca olvidaré tu cara, cubriéndote la boca de emoción, cuando te adelantaste y viste la sala donde se recrea la estación de tren... o al final, donde está la maqueta 1:24 de Howarth...

En estas que estoy escribiendo y pasas por aquí y .aceptas escribir un poco... seguro que todos prefieren que remates el divague, así que yo termino con MUCHAS FELICIDADES RUBIA, que pases un día maravilloso y que en los diez  lo pases chimenea!

"Hola, soy Mini, la que siempre se olvida escribir en su Blog. 10 años para mi es como raro, me siento rara, pero, luego me acuerdo cuantos años tienen mis padres y luego ya no me siento tan viega. Algunas veces durante el año, no puedes esperar para tu cumple, estas emocionada todo el ano, eso es lo que me pasa a mi todo el año, de hecho, obligaba a mis padres poner cuantos dias faltaban para mi cumpleanios en mi pizzarra TODOS los dias en una epoca. Bueno, cuando solo falta un segondo para mi cumpleanios, yo me sientia como he esperado tanto para este momento, pero luego, no termina como yo planeaba. Siempre me miro como una persona mas dedicada cuando cumplo cada ano, pero, como ya te puedes imajinar, soy la misma persona, no cambio y posiblemente nunca cambiare. Veras, yo nunca encuento el tiempo para escribir en mi blog, mi madre siempre esta, tacatacatacatacatacatacatac con el ordenador. Este ano, voy a intentarlo de nuevo, y si para por lo menos un semana funciona, ya te dire.

No puedo espera para mi cumpleanos, un martes con mis amigos, me siento viega pero alegre y siempre tengo ganas de pasarmelo bien. Con eso dicho, muchas gracias por leer mi parte de la historia y espero que difruties lo resto que pondra mi mami. Adios!!!!😊😊😊😊😊😊😜😛😘😁😁😝"

29 de abril de 2018

El final de mil silencios es el principio de otro mundo

3 divagues
Hace unos meses empecé un divague, allá por la época cuando publiqué mi análisis del relato "Cat person" (que aniadió un punto más a la campania #MeToo de gente de Hollywood que a propósito de Wenstein empezaban a decir que ellas también habían sido presionadas, abusadas o violadas). Aquel relato me tocó mucho (ya expliqué que lo leí con el corazón encogido) porque, primero, no era difícil empatizar con la protagonista aunque no hubieras vivido algo similar, pero, segundo, porque como todas las mujeres que conozco, he sido acosada por ser mujer, de una u otra forma, muchas veces. El borrador de aquel divague, sobre mi particular #MeToo se quedó ahí, enterrado entre otros divagues de libros, Londinium, pelis, viajes y anécdotas. Enterrado, pero no olvidado.

El coraje llama al coraje en todos los sitios, Millicent Fawcett
Luego vino el 8 de Mayo. Escribí otro divague enorme, un panfleto feminista, lleno de rabia y de ganas a la vez. Se me fue de las manos, como a veces pasa: era larguísimo, no tenía foco y tocaba mil temas, entre ellos el #MeToo. Al final lo resumí  de mala manera y salí por la tangente con una manera muy típica en mí: el humor. Colgué un video de risas y (me hice creer que) pasé página. A ver, no digo que el humor no sea una manera excelente de pensar y hacer pensar, pero lo cierto es que es un mecanismo de defensa. Pero el Pepito Grillo en mi hombro cada vez en voz más alta me decía de qué vas.

Por qué no publiqué?

Por qué? No puede ser vergüenza: racionalmente sé que estas situaciones no han sido mi problema, sino el de ellos. Por qué entonces? Tirando del hilo llego a mi legendaria aversión a ser compadecida, odio el papel de victima, detesto dar pena (aunque tristemente, como todos, muchas veces la dé).  No quiero que la gente me anime ni que me den palmaditas en el hombro. Pero... hasta cuándo se justifica este orgullo cuando hablamos de un problema que nos afecta a todas, que ya no es personal, sino político?

Anoche me impactó escuchar a una monja de clausura en la SER y su frase: "Tenemos responsabilidad con nuestras palabras y con nuestros silencios". Me pareció especialmente bonito el uso de la palabra silencios, ellas que viven sin ruido, sin cosas, sin prisas. Y aún así, decidieron romper su silencio para decir que hay silencios cómplices. Volvemos al famoso "vinieron a por los judíos, pero no dije nada, porque no era judío". Así que anoche decidí que tenía que desempolvar aquel divague y publicarlo, aunque me costase. Porque encima, soy mujer y como a casi todas, me ha pasado. 

La primera vez, esto sí que lo conté, me pellizcó el culo otro ninio con 9 anios en unos campamentos. Le metí una patada enorme con las chirucas, pero aún hoy recuerdo lo fatal que me hizo sentir. Lo terrorífico es que a Mini esto mismo ya le ha pasado-en un colegio en Vetusta al que fue durante sus vacaciones británicas. Y vi en su cara que se sentía exactamente igual que yo, décadas después. 

Cuando tenía 13 anios iba andando con un grupo de amigas, y de repente, nos pitaron desde una furgoneta. Recuerdo perfectamente la calle. Me interesé por ver si eran conocidos de alguna de ellas y una me aclaró: "no sabías que cuando un grupo así de chicas va por la calle, los hombres pitan?"

No lo sabía, pero vaya que si lo aprendí, y también aquello otro de lo que suponía pasar sola por delante de un grupo de tíos. Había que desviar la mirada, disimular, y pasar lo más rápido posible. En el Reino Unido, desde el principio noté que esto era menos prevalente que en la península (por no hablar de Italia, claro, o en Egipto donde literalmente casi se me lleva una marabunta de tíos que me rodeó), pero también se da (recordemos sin ir más lejos este tío haciendo gestos masturbatorios sin dejarme mover el coche). Aún a día de hoy, cuarentaybastantes, sigo como acto reflejo esperando lo peor cuando paso por ciertos grupos de hombres. 

Fui a un cole de monjas y solo chicas, así que afortunadamente no tengo historias de profesores que se pasan en esa época, aunque no me libré de que por ejemplo me tocaran el culo en un partido de baloncesto a los 15. En aquella época, seguro que me sentí culpable por haberme subido a esa valla. En la facultad tampoco hubo incidentes, aparte de un profe de prácticas que me preguntó si "hacía algún deporte", y yo, inocente, debí dar explicaciones que le importaban un pepino porque lo que quería es decirme "cómo mantienes ese cuerpo".  

Cuando empecé a trabajar, ya en la isla, yo aún era una inocentona del diez. Un día, un compañero de trabajo (que estaba casado, tenía 5 hijos, y era predicador de nosequé religión) me dijo que me había traído los libros que le encargué y que los subiera a buscar a su piso. Vivíamos en residencias al lado del trabajo, y él tenía a la familia en otra ciudad. Subí, sin más, y una vez arriba me dijo que "le diera un beso". Evidentemente me fui horrorizada y el surrealismo siguió los demás días, en los que vino llorando, diciendo primero que teníamos que limitar nuestro tiempo juntos (culpándome, no me podía ver) y luego "que lo había hecho para comprobar si yo era fiel a mi novio" (claro, hay que entenderle, era predicador, ese es su trabajo). Sí, lo sé, es enloquecido, pero así de anormal es alguna gente ahí afuera. Ayer, hablando de estos temas con mis padres, que están aquí, les conté esta historia, que no les había contado jamás. Se quedaron en shock, enfadados, tristes. 

Alguna gente, por lo que una lee por ahí dirá, "por qué subiste al piso de ese predicador". Será culpa de una mujer, confiada, el que un hombre sea un cerdo. Seguro que muchas miramos atrás y recordamos cosas que, por culpa de otros, de ellos, pueden ser catalogadas de "imprudencias". Quién no ha ido de noche andando de un pueblo en fiestas a otro, quién no se ha metido en el coche de una gente que has conocido esa noche en Ibiza para ir a otro bar, quién no ha vuelto a casa sola en un taxi que a saber quién lo conducía? Ese pavor aún lo recuerdo, el del taxi y la posibilidad de que fuera un tipo que "te llevara a un descampado". A la hermana de un amigo la intentaron llevar. 

No soy ni tengo apariencia de mosquita muerta, y puedo ser muy directa, y aún así he sufrido a hombres que han intentado presionarme aprovechando que ellos eran tíos en distintos aspectos (amoroso-sexual, y también profesional). Con ellos he lidiado de distintas maneras, cada vez mejor según avanzaba mi edad. Y esto es verdaderamente sobrecogedor: cuanto más joven eres, menos equipada estás para combatir estas mierdas, y cuando pienso en Mini, me revuelvo. Porque estas mierdas no tendrían que estar pasando, ni seguir pasando. 

Leyendo lo que mucha gente ha escrito estos días sobre sus particulares #MeToos me he dado cuenta de que, en el fondo, he tenido mucha suerte. Todo lo que me ha ocurrido es menor, pero me ha ocurrido. Y lo escribo aquí hoy solo para agredecerles a las valientes que han compartido situaciones verdaderamente traumáticas, abusos y violaciones muchas desde ninias, y por su propia familia, que hayan dado un paso más para contarlo. 

Porque si algo no se cuenta, no ha pasado, y si no ha pasado, no hay que cambiarlo. 

Por eso hasta las monjas de clausura han decidido romper su silencio. 

26 de abril de 2018

"La soledad del corredor de fondo" de Allan Sillitoe: Look back in anger

4 divagues

"La soledad del corredor de fondo"  ("The loneliness of the long-distance runner") es un libro de relatos de Allan Sillitoe, publicado en 1959. También se hizo una película en 1962.

Sillitoe pertenece a los "angry young men" (jóvenes cabreados), un grupo de escritores de los anios 50, a los que no gustaba esa etiqueta.  Entre ellos están también Kingsley Amis, John Osborne. Dicen que el nombre viene de la promoción de la obra de teatro de este último "Look back in anger" (1956). [Divague: cómo me gusta ese título, "mira hacia atrás con ira"... seguro que inspiró a los Oasis para su "Don't look back in anger", una canción que también me encanta). Cierro paréntesis]. Por qué estaban furiosos estos chavales? dicen que estaban desilusionados con la sociedad británica tradicional. [Más divague: a veces me planteo el porqué de ese demesdido culto por lo "tradicional", mantener las  costumbres, incluso cuando en gran parte son basura (o cuando miras alojamiento de vacaciones y dicen "casa tradicional-suele ser un chamizo). En mi libro de filosofía pop he conocido a Jurgen Habermas, que dice "la sociedad depende de la crítica de sus propias tradiciones. Porque las tradiciones no son necesariamente en el interés de los individuos, y hemos de ser capaces de cuestionarlas, razonando en la esfera pública para construir consenso, que traiga cambio y así haga más fuerte a la sociedad".  Me tranquiliza que no soy la única iconoclasta del barrio.]

En "La soledad del corredor de fondo", Sillitoe nos cuenta la historia de un adolescente pobre de Nottingham (de donde era Sillitoe) que está en un centro de detención de menores delincuentes (lo que antes aquí se llamaba Borstal) de esos cuya filosofía es "reintegrar en la sociedad". Ya saben: educar, en lugar de castigar, para que estos chavales volvieran al camino adecuado. Talleres de carpintería, punto de cruz, algo de gimnasia, tal vez terapia y voilá! Los jóvenes delincuentes ya están listos para salir amando a la vida y a la sociedad porque, total, por qué estaban en borstal? Por el pecado de ser haber nacido en una "familia desfavorecida". Esto era así en la época que se escribió este libro, y lo sigue siendo: mayoritariamente las cárceles están llenas de pobres. Y si el país es multicultural, de pobres negros. 

En el particular reformatorio que está nuestro protagonista, los directores y demás chusma quieren que los chavales corran para que ganen nosequé trofeo que dará mayor gloria al establecimiento, "queremos trabajo duro honesto, y queremos buenos atletas".. Y es que nuestro héroe es muy bueno corriendo-comienza el libro con la broma "en mi familia lo somos, especialmente escapando de la policía".  Pero nuestro chico tiene una rebeldía y una ira tal que les da un corte de mangas desde la primera línea. Esto es lo que más me ha gustado del relato, su tono eminentemente anárquico, desafiante, oposicional. A la mierda todos. 

A la mierda el ejército también: "me querrán meter en el ejército, los cabrones... pero cual es la diferencia entre el ejército y la cárcel?". Me encanta el profundo antimilitarismo del libro. "Mandándome al reformatorio me han enseniado el cuchillo, y ahora sé que hay guerra entre ellos y yo. Sé cuales son mis enemigos y cual es la guerra" Me encanta que en el fondo está hablando de la lucha de clases: a él le da igual que tiren bombas, las guerras del gobierno no son la suya, y nunca irá a luchar por su patria o los valores de la sociedad bien-pensante que quiere que se reforme. No, él tiene su propia guerra, nació en su propia guerra. 

A la mierda los carceleros, a los que considera muertos, en contraste con él, que está vivo: ellos no podría correr ni la quinta parte de lo que corre él, colapsarían. Están muertos. Son tipos así que tienen la voz cantante sobre chavales como él... y él prefiere pasarse toda la vida en la cuerda floja que ser un muerto viviente como ellos. Tal vez cuando llevas la voz cantante sobre otros es cuando empiezas a estar muerto."Sed honestos", dijo el director un día, y a él le sonó como "Estad muertos, como yo". "Sed honestos en un trabajo de £6 como yo"

“Don't let the bastards get you down.”  

Y para terminar, lo que encuentro fascinante del relato es cómo el protagonista nos lleva de la mano sobre la experiencia de correr. Y esto lo escribe alguien que no le gusta correr resistencia, y que no puede entender la fiebre que aqueja a muchos de sus amigos, conocidos, y vecinos, a juzgar por cómo está el parque de delante de casa: siempre hay alguien corriendo. Pues bien: leyendo el relato me llegué plantear intentar correr, una vez más, probar a ver si por fin me daba esa mística o esa droga que a buen seguro son las endorfinas que los tienen a todos enganchados-pero que a mí no me llegan, tal vez porque no me expongo el suficiente rato al dolor. (Lo volví a intentar. Un día. No es mi momento)

Lo primero, hay que tener en cuenta que esto fue escrito en 1959, cuando ninguna tontuna del correr existía. En aquella época yo no había nacido, pero en los 70 yo solo conocía que corriera a mi padre en vacaciones en Bellver, que se iba pronto a la montana con un chándal azul marino con rayas laterales, como el de Di Stefano (mi primo). Pues bien, ya en 1953 Sillitoe pone en boca de un chaval de reformatorio conceptos como lo que se piensa cuando uno corre ("el discurrir" del paseante, pero a más velocidad). Sillitoe es un visionario. 

El chaval nos cuenta cómo los cabrones de los carceleros podrán leer su comportamiento, pero no su mente, que se desata al correr. Ese correr que es "50 veces mejor que beber". Habla de momentos mágicos corriendo en los que la mente se le queda en blanco, no hay un solo pensamiento, o palabra o imagen en su mente, está vacía. 

"I'm the only one in this running bussiness with this system of forgetting that I'm running because I am too busy thinking".

Y cree que pensar profundamente es tonto, porque te lleva a ningún sitio, pero correr por la maniana temprano es como "una pequenia vida"

"If any of you want tips about running, never be in a hurry, and never let any of the other runners know you are in a hurry even if you are... I ran to a steady jog-trot rhythm, and soon it was so smooth that I forgot I was running, and I was hardly able to know that my legs were lifting and falling and my arms going in and out, and my lungs didn't seem to be working at all, and my heart stopped that wicked thumping I always get at the beginning of a run. Because you see I never race at all; I just run, and somehow I know that if I forget I'm racing and only jog-trot along until I don't know I'm running I always win the race... I was in my element that afternoon knowing that nobody could beat me at running but intending to beat myself before the day was over". 

Si quieres consejos para correr, no vayas con prisa. No compitas, solo corre. Y cosas así, que supongo servirán para forrar las paredes de algunos fanáticos del correr. Pero lo mejor es cómo nuestro chico cierra el tema, cómo se rebela, boicotea, jode. Y rechaza ganar su carrera, la del director. 

Rechazando ganar no solo les ensenia el dedo del centro al director del borstal y los demás encorbatados, sino que les ensenia cómo sus carreras nunca tienen un ganador aunque haya un tipo que llegue el primero. 

Porque el prota, como Sillitoe, está cabreado. Y tiene demasiadas razones para "look back in anger" (I heard you say).

21 de abril de 2018

Como nos sobra el tiempo, hoy: "Colonia Marciana"

15 divagues
Como ya divagamos anteriormente, en el colegio de Mini consideran que es interesante -y tal vez positivo para nuestro desarrollo- que los padres hagamos, un par de veces al anio, lo que antes se conocía como manualidades, hoy lo llamaremos pequenias-obras-del-pilar. Los espumarajos, sapos, y culebras ya los eché todos aquí, cuando hubo que hacer un "invento victoriano", y la pobre Mini llevó una bombilla, mientras que los padres de otros  ninios se curraron puentes de suspensión.

Parecía imposible, pero esta vez se han superado: para nuestro entretenimiento de Semana Tonta el sádico de turno eligió que construyéramos una "MARS COLONY" (una Colonia Marciana, un potencial asentamiento humano en Marte). Socorro.  Un día, cuando aún no me creía que esta era verdaderamente la misión, planteé el tema por aquí medio jiji jaja, y el divagante LUX se descolgó con uno de sus juegos de palabras que resultó una gran idea: enviar la ninia al cole con un frasco de colonia al que le pegaríamos un marcianito, verde, claro. Incluso el emoji del comecocos podría servir.

Pasaron los días. Lo olvidé. Misión abortada. Mini se quedó con sus dos tandas de abuelos en la península durante las vacaciones, y yo volví a la isla sin preocupación. Claro que, al ir pasando los días, Mini empezó a dejar caer insinuaciones por teléfono: "Os acordáis de la Colonia Marciana?" Estaba claro que no íbamos a hacer ninguna colonia, aunque las conversaciones se hacían cada vez más insistentes:
- "Mummy, Daddy, tenéis ya los materiales?"
- "No"
-" Pero... jooo"
-"Esto no es para que aprendan los ninios, objeto a hacerlo para más gloria del cole y blabla.."
- "Id empezando vosotros".  
- "Ya lo harás con el Yayo el domingo que tenéis un día entero"
- "Pero id empezando vosotros"

Otro día:
- "Mummy, daddy, estoy bajo mucha presión, qué pasa con la colonia". 
- "He traído del curro un cartón grande -un calendario planner de 2017- que hará de base"
- "Pero solo eso? Es toda una colonia, con sistema de agua, comida, almacenes..."
-  "Mini, pero que no sabemos hacerlo!"
- "Just google it!" (guglealo!). 


Mini llega el sábado por la noche con sus abuelos, y mi pobre padre (que ya se había chupado mis manualidades escolares) se pasa todo el día con ella diseniando la colonia. Tiene invernadero, y molino (con su fidget spinner), y más cosas que a saber qué representan pero que en su día fueron, por ejemplo, un objetivo de mi vieja Nikon. 

Hoy ha sido el día de Puertas Abiertas y... Mini  y Lisi han triunfado!!! Un gran trabajo la colonia marciana...

Pero la pequenia ácrata que hay en mí sigue inspirada por la idea de LUX, y aniora no haber enviado un frasco de Varón Dandy con E.T., por ejemplo: como además el juego de palabra es intraducible la broma se habría perdido en el éter, el éter de los ejpanioles. 

Así que para desquitarme, le pido ayuda a JAL (el Padre de todos los Kuniados) que me prepara lo que de verdad hubiera querido enviar al colegio como Colonia Marciana... ehem... Marxiana... Marxista!

Para ella, para él, en su bonito packaging les presentamos la nueva fragancia para esta primavera... MARX COLONY.

Marx Colony: Parents of the world, UNITE!

14 de abril de 2018

"Farenheit 451" de Ray Bradbury: Porno para bibliófilos

32 divagues

"Farenheit 451" es de esos libros que una no recuerda si fue leído en Uruguay o qué, porque se lía con "Un mundo feliz", "1984", "La naranja mecánica", "The handmaid's tale" y otras distopías lejanas. El caso es que yo no lo había leído, pese a estar en la estantería desde hace siglos al ladito (ordenamos por autor, no color de la tapa) de "Crónicas marcianas", esperándome. 

Todo el mundo conoce el argumento de "Farenheit 451", que es la temperatura a la que arde el papel: los bomberos de este futuro terrible en lugar de apagar incendios, los encienden: queman libros (“It was a pleasure to burn", otro de los comienzos famosos de la literatura). La imagen de pilas de libros quemándose es tan fuerte, la hemos visto en tantas pelis de nazis-o de Indiana Jones, que podría resultar facilona como metáfora, pero hay que entender que el libro fue escrito en 1953. Esta cifra, más que el 451, es la que me ha maravillado más durante la lectura. 

Prefacio: el proceso de escribir
Pero antes de empezar, el libro de Bradbury tiene un prefacio maravilloso escrito por el autor en 1993. En él cuenta todos los problemas que tuvo para publicar lo que en principio eran historias cortas, como por ejemplo "Bonfire", en la que el protagonista reflexiona sobre sus grandes pasiones la noche antes del fin del mundo: Aristóteles, El Greco, Swift, Renoir, Faulkner, Miguel Angel, Shakespeare, entre otros. Se puede ver un granito de lo que luego sería Farenheit: qué ansiedad, perder todo esto. También nos cuenta cómo un día iba paseando y hablando con un amigo por las calles de LA, cuando un coche de policía paró para preguntarles "qué estaban haciendo". Cuando le dijeron que "andando y hablando", el poli pareció preocupado. Imagínese, alguien andando en LA!!! Y hablando!!! Qué traman? A partir de aquí Bradbury escribió el relato "The Pedestrian", sobre un futuro donde caminar por el placer de hacerlo estaba prohibido. Ambas historias son gérmenes de Farenheit. Además en este prefacio nos habla de su proceso como escritor, cositas que a los que intentamos juntar palabras siempre nos encanta leer. Atención a esto:

“I cannot possibly tell you what an exciting adventure it was, day after day, attacking that rentable machine, shoving in dimes, pounding away like a crazed chimp […] I was, like Melville’s hero, madness maddened. I had no way to stop. I did not write Fahrenheit 451, it wrote me. There was a cycling of energy off the page, into my eyeballs, and around down through my nervous system and out through my hands. The typewriter and I were Siamese twins, joined at the fingertips.”

No escribí Farenheit 451, ella me escribió a mí: qué maravilla, y cómo le entiendo. "Soy un escritor pasional, no intelectual, lo que significa que mis personajes deben zambullirse antes que yo para vivir la historia. (...) Montag corrió, y le seguí, y estoy agradecido de que escribiera esta historia". Me he quedado con ganas de leer su libro "Zen and the art of writing", que debe ser un festival. Una última frase sobre su proceso de escritura:  "Every morning I jump out of bed and step on  a land mine. The land mine is me. After the  explosion, I spend the rest of the day putting the  pieces back together. Now, it's your turn. Jump!"  Zest. Gusto. Curiosity. These are the qualities  every writer must have, as well as a spirit of  adventure. 

Entrando en la novela, enseguida conocemos a Guy Montag, el bombero que nos va a guiar, vía de "El viaje del héroe" que se repite en toda historia que se precie (el héroe en cuestión sale de su zona de confort, se confronta con nuevas verdades, sufre una transformación, expiación y regreso/resolución). Nota: este es un concepto acuñado por Joseph Campbell, el de "El héroe de las mil caras", del que no puedo hacer un divague porque es un libro infumable: Campell está profundamente influido (tarado) por Freud y demás panda de payasos pseudocientíficos, así que no pasé del primer capítulo. Pero la idea del viaje del héroe es interesante y se puede aplicar desde Ulises hasta E.T., pasando por Jesucristo. Y también aquí. Pero divago. La historia se divide en tres partes, de las que yo he disfrutado in decrescendo, porque al principio se nos presenta ese mundo extranio y hostil, y a medida que avanza, hay más acción, hay que resolver. 

El valor predictivo de la ciencia ficción
Parece obvio decir, ya que se ha escrito mucho sobre la capacidad de la ciencia ficción para hacer predicciones de lo que luego vendrá, pero con esta novela yo me he maravillado constantemente por la casi exactitud con la que describe lo que es la vida de alguna gente a día de hoy. Por ejemplo, Mildred, la mujer de Montag, está totalmente absorbida por las posibilidades tecnológicas de esta sociedad: desde el "parlour" hasta las "abejas electronicas". El "parlour" es su máxima aspiración: una habitación donde las cuatro paredes son en su totalidad pantallas, y en ellas se proyecta 24 horas gente (que pasan a ser como su familia) que hablan sin parar y discuten entre ellos. Erm, un momento: no es esto un resumen de la programación de Tele5? Porque no hay más que pasar de puntillas con el mando y ver a los mismos gritándose entre ellos, lo escalofriante  pensar en los millones de personas que están siguiéndolo desde casa. Mildred y Montag no tienen hijos, pero la gente que los tiene, cuando vienen del cole los enchufan a este "parlour" y ya está "es como hacer la colada, los metes dentro y cierras la puerta". Qué imagen. 

Las "abejas electrónicas" también tienen un paralelismo actual. Alguien ahí adicto al podcast? Doy un paso al frente: siempre que hago actividades que no requieren concentración (viajar, llenar el lavaplatos, ducharme), estoy escuchando la radio. Pues los habitantes de este futuro están enganchados a algo que son esencialmente podcast, usados aquí para adormecer, cuando yo me cuento a mí misma que lo que escucho es para informarme. Me imagino a las hordas caminando como zombies, con el zumbido de las abejas de fondo. escuchando tal vez consignas, y sin escucharse entre ellos. 

Nobody listens anymore. I can't talk to the walls because they're yelling at me, I can't talk to my wife; she listens to the walls. I just want someone to hear what I have to say. And maybe if I talk long enough it'll make sense. And I want you to teach me to understand what I read.”

Bradbury lo usa como metáfora de la falta de comunicación entre la gente, y con uno mismo... "Mildred, la otra Mildred, está tan dentro de esta, que nunca se han conocido".  La muñeca rusa Mildred, la cebolla Mildred. 

Y hay más imágenes como estas, como el banco abierto toda la noche con robots como dependientes, o la pantalla de televisión del tamanio de una postal, "algo a lo que pudiera hablar" (no está describiendo un "teléfono inteligente"?). Todas te dejan un poco petrificada, la realidad virtual, los robots que trabajan, todo esto está ya aquí. Lo queremos todo? Parte? Habrá que repasar "Homo Deus". 

Complejidad? No gracias! La cultura popular es mala para su salud
Una no puede dejar de pensar qué diría Bradbury de la sociedad en la que vivimos hoy. El autor dijo repetidas veces que su novela no iba de la censura, sino de la idiota influencia de la cultura popular en la población, que queda adormecida. Todo lo que sea un mínimo de complejidad se descarta, porque lo que interesa es algo ya medio masticado, de consumo rápido, que entretenga, que no nos lleve a plantearnos nada. 

"Picture it. Nineteenth century man with his horses, dogs, carts, slow motion. Then, in the twentieth century, speed up your cameras. Books cut shorter. Condensations. Digests. Tabloids. Everything boils down to the gag, the snap ending. (...) Speed up the film, Montag, quick. Click, Pic, Look, Eye, Now, Flick, Here, There, Swift, Pace, Up, Down, In, Out, Why, How, Who, What, Where, Eh? Uh! Bang! Smack! Wallop, Bing, Bong, Boom! Digest-digests, digest-digest-digests. Politics? One column, two sentences, a headline! (...) School is shorted, discipline relaxed, philosophies, histories, languages dropped, English and spelling gradually neglected, finally almost completely ignored. Life is immediate, the job counts, pleasure lies all about after work. Why learn anything save pressing buttons, pulling switches, fitting nuts and bolts?"

Programas de "cultura general" donde se bombardea a los participante con preguntas sobre datos sin análisis (en qué anio tal batalla? sin preocuparnos por qué esa batalla). Interesa el porqué no el cómo. Madre mía: qué diría Bradbury hoy de Twitter, por ejemplo? 

“If you don't want a man unhappy politically, don't give him two sides to a question to worry him; give him one. Better yet, give him none. Let him forget there is such a thing as war. If the government is inefficient, top-heavy, and tax-mad, better it be all those than that people worry over it. Peace, Montag. Give the people contests they win by remembering the words to more popular songs or the names of state capitals or how much corn Iowa grew last year. Cram them full of noncombustible data, chock them so damned full of 'facts' they feel stuffed, but absolutely 'brilliant' with information. Then they'll feel they're thinking, they'll get a sense of motion without moving. And they'll be happy, because facts of that sort don't change.”   

Qué diría de que no se estudie latín, filosofía, de que la universidad sea una fábrica de empleados en lugar de un lugar donde aprender a pensar, y que, en búsqueda de mejor empleo, la gente solo quiera acumular trozos de papel llamados títulos, aunque sean de mentira?

Para tener adormecida a la población, el poder siempre ha usado el "panem et circenses", desde ver a cristianos ser devorados por leones, hasta la propia religión ("el opio del pueblo", gracias tío Karl) cuando se hace mainstream y en estos momentos, parece haber múltiples opciones, pero tal vez la mayor sea el (puto) deporte. Lo siento, a mí aburre el deporte y sinceramente, lo del fútbol no lo entiendo (pese a tener una bandera de la Real Sociedad colgada junto al albornoz en la puerta del dormitorio). No puedo ser indiferente: me pone enferma ver los titulares del periódico, y la proporción de deportes en ellos, por no hablar del tiempo que le dedican en los telediarios. Es la "terrible tiranía de la mayoría": el más peligroso enemigo de la verdad y la libertad: el sólido inmóvil ganado que es la mayoría".

More sports for everyone, group spirit, fun, and you don’t have to think, eh? Organize and organize and super organize super-super sports. More cartoons in books. More pictures. The mind drinks less and less. Impatience. Highways full of crowds going somewhere, somewhere, somewhere, nowhere. The gasoline refugee. Towns turn into motels, people in nomadic surges from place to place, following the moon tides, living tonight in the room where you slept this noon and I the night before.”

Autopistas llenas de gente yendo a algún sitio, algún sitio... Tengo unos conocidos que no tienen hijos y mucha pasta, y raro es el fin de semana que están en casa: París, tan a mano con el tren, o Bruselas, o Cracovia, o Turín. Continuamente empacando, moviéndose, digiriendo una nueva ciudad, un nuevo plato, una nueva ópera. Continuamente, sin parar: qué pasaría sin un finde se quedan en casa y en un punto, en el sofá, tienen que parar? Qué se encontrarían? Otra predicción tickada, Ray.

Quién será de más culpar?
Aparte del deporte, quedan los comics, las revistas de sexo tridimensionales, y los video juegos (esto no lo predijo Bradbury), pero lo que asusta es que todo esto ni siquiera vino como un dictado del gobierno, de arriba abajo... no hizo falta censura: la tecnología y la imbecilidad de la gente hizo la magia sola.  Como dijo el Jefe de Bomberos: "Porque no tienes que quemar libros, no?, cuando el mundo se llena de no-lectores, no aprendedores, no-sabedores" (non-readers, non-learners, non-knowers).  Los libros eran quemados sin necesidad de fuego.

Y lo que no eran imbéciles, no dijeron nada; la idea aquella de vinieron a por los judíos y no me quejé está también en la novela: qué estamos haciendo nosotros para parar este horror que se nos viene? 

“Mr. Montag, you are looking at a coward. I saw the way things were going a long time back. I said nothing. I am one of the innocents who could have spoken up and out when no one would listen to the 'guilty,' but I did not speak and thus became guilty myself.”

Cómo pararlo? La respuesta es, me temo, como siempre, la unión. Como le dicen al final del libro los que viven en los márgenes de esta sociedad, donde sobreviven memorizando libros subversivos, los clásicos:  "cuando estábamos solos, todo lo que teníamos era furia", y le aconsejan que viva, que vea el mundo, y sobre todo que lo intente, sin pedir garantías, aunque se quede ahí:

Stuff your eyes with wonder, he said, live as if you'd drop dead in ten seconds. See the world. It's more fantastic than any dream made or paid for in factories.”

Don't ask for guarantees. And don't look to be saved in any one thing, person, machine, or library. Do your own bit of saving, and if you drown, at least die knowing you were heading for shore.”  

Apéndice: Porno para bibliófilos

Para terminar en una nota alta, incluyo algunas de las frases que hablan de libros. Porque hay mucho porno-para-bibliófilos, para lo que amamos los libros no solo por su contenido, sino como objetos, su olor, su textura... disfrutad, y seguid leyendo.

“Do you know that books smell like nutmeg or some spice from a foreign land? I loved to smell them when I was a boy. Lord, there were a lot of lovely books once, before we let them go.”

“The magic is only in what books say, how they stitched the patches of the universe together into one garment for us.” 

“The books are to remind us what asses and fool we are. They're Caeser's praetorian guard, whispering as the parade roars down the avenue, "Remember, Caeser, thou art mortal." Most of us can't rush around, talking to everyone, know all the cities of the world, we haven't time, money or that many friends. The things you're looking for, Montag, are in the world, but the only way the average chap will ever see ninety-nine per cent of them is in a book. Don't ask for guarantees. And don't look to be saved in any one thing, person, machine, or library. Do your own bit of saving, and if you drown, at least  knowing you were headed for shore.” 

“A book is a loaded gun in the house next door...Who knows who might be the target of the well-read man?”